| MirGeneDB ID | Ete-Mir-34-P3b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-34 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCAGUG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-34-P1 Ete-Mir-34-P2a Ete-Mir-34-P2b Ete-Mir-34-P3c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-34 Ami-Mir-34-P3b Asu-Mir-34 Bge-Mir-34 Bta-Mir-34-P3b Cbr-Mir-34 Cel-Mir-34 Cfa-Mir-34-P3b Cgi-Mir-34 Cin-Mir-34 Cli-Mir-34-P3b Cmi-Mir-34-P3b Cpi-Mir-34-P3b Cte-Mir-34 Dan-Mir-34 Dma-Mir-34 Dme-Mir-34 Dmo-Mir-34 Dpu-Mir-34 Dsi-Mir-34 Dya-Mir-34 Efe-Mir-34 Esc-Mir-34 Gga-Mir-34-P3b Gja-Mir-34-P3b Hsa-Mir-34-P3b Isc-Mir-34 Lch-Mir-34-P3b Lgi-Mir-34 Loc-Mir-34-P3b Mdo-Mir-34-P3b Mml-Mir-34-P3b Mmu-Mir-34-P3b Npo-Mir-34 Oan-Mir-34-P3b Obi-Mir-34 Ocu-Mir-34-P3b Ovu-Mir-34 Pbv-Mir-34-P3b Pfl-Mir-34 Pma-Mir-34-P3 Pmi-Mir-34 Rno-Mir-34-P3b Sha-Mir-34-P3b Sko-Mir-34 Spt-Mir-34-P3b Spu-Mir-34 Sto-Mir-34-P3b Tca-Mir-34 Xbo-Mir-34 Xla-Mir-34-P3b1 Xla-Mir-34-P3b2 Xtr-Mir-34-P3b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980308: 48340498-48340558 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) | UGUGGAAAGGAGCAGUGGCCAGAAUCAGGUAGGCAGUGUACUGUUAGCUGGCUGUGUUGGGUCAAUUCAGCAGCCACGACUACCCUGCCACUUGCUUCUGGAUAAACUCAUCUUGUUAAUGGet precursor sequence | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UGUGGAAAGGAGCAGUGG--| U A U CU AGC GUUGGG CCAGAA CAGGU GGCAG GUA GUU UGGCUGU U GGUCUU GUUCA CCGUC CAU CAG ACCGACG C GUAAUUGUUCUACUCAAAUA^ C - C -- C-- ACUUAA . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | This is a Group 2 in human according to Kim et al but because there is a templated 3' U it is not possible according to read data to classify it as such in other taxa although the secondary structure is consistent with this categorization. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-34-P3b_5p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGCAGUGUACUGUUAGCUGGCUGUG -26
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-34-P3b_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- CAGCAGCCACGACUACCCUGCCAC -61
Get sequence
|
