| MirGeneDB ID | Xla-Mir-451-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-451 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | African clawed frog (Xenopus laevis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Xla-Mir-451-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-451 Ami-Mir-451 Bta-Mir-451 Cfa-Mir-451 Cja-Mir-451 Cli-Mir-451 Cmi-Mir-451 Cpi-Mir-451 Cpo-Mir-451 Dno-Mir-451 Dre-Mir-451 Ebu-Mir-451 Eca-Mir-451 Ete-Mir-451 Gga-Mir-451 Gja-Mir-451 Gmo-Mir-451 Hsa-Mir-451 Laf-Mir-451 Lch-Mir-451 Loc-Mir-451 Mal-Mir-451 Mdo-Mir-451 Mml-Mir-451 Mmr-Mir-451 Mmu-Mir-451 Mun-Mir-451 Neu-Mir-451 Oan-Mir-451 Ocu-Mir-451 Pab-Mir-451 Pma-Mir-451 Rno-Mir-451 Sha-Mir-451 Spt-Mir-451 Sto-Mir-451 Tgu-Mir-451 Tni-Mir-451 Xtr-Mir-451 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | X. laevis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001663975.1_XLA_v2) |
NC_030726.1: 32856944-32856985 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-451-P1) |
Mir-144-P1-v1
NC_030726.1: 32856364-32856421 [+]
UCSC
Ensembl
Mir-144-P1-v2 NC_030726.1: 32856364-32856421 [+] UCSC Ensembl Mir-451-P1 NC_030726.1: 32856944-32856985 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AACCGUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UAUUGGAUGGAGACGUGUAGGGUGGCAAUGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAGGGUUCUGUUGCUGCUCUUCCAUUCGCCUUUGAGAUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UAUUGGAUGGAGACGUGU--| UG GA G A AGGG GCAAU AACC UUACCAUUACUG G UCUC CGUUG UUGG AAUGGUAAUGAU U CUUAGAGUUUCCGCUUACCU^ GU UC G U 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | As a non-canonical (Group 4, Kim et al. 2016) miRNA there is no discrete 3p read and the 3' end of the mature miRNA is somewhat arbitrary. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | NA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Xla-Mir-451-P1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AAACCGUUACCAUUACUGAGUU -22
Get sequence
|






