| MirGeneDB ID | Sto-Mir-130-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-130 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-130-P1a Sto-Mir-130-P1b Sto-Mir-130-P1c Sto-Mir-130-P2b Sto-Mir-130-P3a Sto-Mir-130-P3b Sto-Mir-130-P3c Sto-Mir-130-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-130-P2a Ami-Mir-130-P2a Bta-Mir-130-P2a Cfa-Mir-130-P2a Cja-Mir-130-P2a Cli-Mir-130-P2a Cmi-Mir-130-P2a Cpi-Mir-130-P2a Cpo-Mir-130-P2a Dno-Mir-130-P2a Dre-Mir-130-P2a1 Dre-Mir-130-P2a2 Eca-Mir-130-P2a Gga-Mir-130-P2a Gja-Mir-130-P2a Gmo-Mir-130-P2a1 Gmo-Mir-130-P2a2 Hsa-Mir-130-P2a Laf-Mir-130-P2a Lch-Mir-130-P2a Loc-Mir-130-P2a Mal-Mir-130-P2a1 Mal-Mir-130-P2a2 Mml-Mir-130-P2a Mmr-Mir-130-P2a Mmu-Mir-130-P2a Mun-Mir-130-P2a Oan-Mir-130-P2a Ocu-Mir-130-P2a Pab-Mir-130-P2a Pbv-Mir-130-P2a Rno-Mir-130-P2a Spt-Mir-130-P2a Tgu-Mir-130-P2a Tni-Mir-130-P2a2 Xla-Mir-130-P2a3 Xla-Mir-130-P2a4 Xtr-Mir-130-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01012481.1: 61702-61763 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-130-P2a) |
Mir-130-P1a
BFAA01012481.1: 61197-61254 [+]
Mir-130-P2a BFAA01012481.1: 61702-61763 [+] Mir-130-P3a BFAA01012481.1: 68285-68351 [+] Mir-130-P4a BFAA01012481.1: 69134-69193 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGUGCAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GCCCUGGGUCAGGGUUGACUGCUGUCGGAGGCUCUGACGAUAUUGCACUACUGUACUCACAGUUAAGCAGUGCAAUAGUAUUGUCAAAGCGUCAGGCACCAGAGAGCGAGCUCCCGUCGACAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GCCCUGGGUCAGGGUUGA-- C G G C ---| A GUACUC CUG UGUC GA GCU UGACGAUAU UGCACU CU \ GAC ACGG CU CGA ACUGUUAUG ACGUGA GA A ACAGCUGCCCUCGAGCGAGA C A G A AUA^ C AUUGAC 120 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha cut +2 on the 5p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-130-P2a_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GCUCUGACGAUAUUGCACUACU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-130-P2a_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- CAGUGCAAUAGUAUUGUCAAAGCGU -62
Get sequence
|
